Mendel's Dwarf (18 page)

GGCATCCTCAGCTACGGGGTGGGCTTCTTCCTG

is exactly complemented by the equivalent sequence on the other, complementary strand:

CCGTAGGAGTCGATGCCCCACCCGAAGAAGGAC

I turn the paper napkin for her to look. “Strings of these paired letters go on and on and on into the distance, like the sleepers of a railway. One side is the message, the other the anti-message. Sense and anti-sense, like a looking glass. Just over a thousand of such paired bases makes up an average gene, but the whole molecule of DNA is longer, far, far longer than that.” I talk the language of megabases—millions of bases—and Jean looks bewildered: “An average human chromosome,” I tell her, “contains a single DNA molecule of eighty million base pairs. That is long, not just in cellular terms but in real terms: It is some
centimeters
long. In each human cell, adding together the forty-six chromosomes, there is a total of about two meters of DNA.”

She shakes her head. “But what’s it all
mean?
It says ‘cat’ there.” She points with one slender and talon-tipped finger to the scrawl on the napkin. “And ‘tag.’ It looks like gibberish to me.”

“But it’s not gibberish to your cells.” In the background, Eric roars with laughter over some new joke a customer has just told him. Nearby, the pinball machine shrieks and whistles. And I
wonder about Jean’s DNA, about her cells, about the very fabric of her body, while she sits there in front of me with her legs artfully crossed so that all I can see above her knees is a triangular tunnel of shadow.

She straightens up to look at me. “So what does this DNA stuff say?”

“It holds the instructions to make you: a phenotypically normal woman, brown haired, slim, good-looking, nervous, self-deprecating, confused about your husband …”

A blush has suffused her cheeks. “All that? Come
on
.”

“Or, with one single, hideous spelling mistake in the whole instruction manual,
me
.”

She is still. The nervous shifting has gone, the blush has paled. Her eyes, those strange, mismatched eyes determined by some error no bigger than the one within me, glisten. “Oh, Ben,” she whispers.

But of course I ignore her little show of emotion, and ignore too the slender hand that reaches across the table to take my stubby one. This is my subject, this is what I do, this is what, for want of a better word, I believe. This is where Ben the scientist takes over from Ben the dwarf. “You must understand that the DNA isn’t
carrying
the message: The message is an integral part of the molecule. The message
is
the molecule. And just so, there isn’t a fundamental
you
that stands outside all this and watches it from some exalted viewpoint, like a reader looking at a book. It’s much stranger than that. You watch it with the machinery that it has created. You understand it—or fail to—with the machinery that it has created. That’s the point. The medium really is the message.”

“You keep saying it’s a message, but if it’s a message, how do you read it? What does it
say?
”

I shrug. “It says proteins. That is all, and that is everything. The message decides the proteins your cells can make, and the proteins determine everything else. There are lots of different
proteins in your cells because there are lots of different things to do, so there are lots of different genes—maybe one hundred thousand in the entire human genome. We’ve not yet finished counting, but it won’t take long.”

“And if the message
means
something,” Jean asks, “who wrote it?”

The Genetic Code

It is not a code. A code is created in order to deceive. No one was trying to hide anything, no God was playing games, creating a conundrum, proposing a puzzle, writing a rebus. The so-called genetic code evolved simply to work. It is not a code: it is a
language
, and a disturbingly simple one. Each word in the language consists of just three letters, any three out of the four,
A, C, G
, and
T
. All possible combinations mean something, which means that the language has just sixty-four words. English has twenty-six letters and a vocabulary of some five hundred thousand words, but the language of the genes, which is sufficient to produce systems that can speak all the languages in the world and understand everything that has ever been understood, this genetic language has but sixty-four words. Furthermore, many of the words are exact synonyms of others—there may be sixty-four different words, but together they have a mere twenty-one different meanings.
¹

There is another simplicity in the system. With almost no exceptions,
²
the language of the genes is universal. The same language is used by your own cells as by the virus that is giving you a head cold, or the bacterium that is giving you a sore throat. The genes that make up the oak tree outside your window and the fly
buzzing against the window pane all speak the same language. All words mean the same thing to all animals and all plants. There has been no Tower of Babel in the history of cellular evolution.

“It seems confusing enough to me,” Jean says. And then she looks at me with a curious directness. That is one of the things I find remarkable about her, her childlike directness. “So where do you fit into all this?” she asks. “What exactly does the great Benedict Lambert do?”

What, indeed? Victim and victor, I probe into the most intimate details of the human genome. Where Uncle Gregor Mendel merely discovered the manner in which inherited factors are passed on from father to daughter or mother to son, I finger his factors and pull them gently to pieces, like a little boy pulling the wings and legs from a fly. I mime the action and evoke a delicious shiver from Jean Piercey. “Or a young girl pulling the petals from a flower. He loves me, he loves me not, he loves me, he loves me not.”

“And the dwarfs?” Her gaze is steady and direct. She possesses a strange courage.

“Ah, yes, the dwarfs …”

I look for meaning among the misprints of life, and so I have become a kind of impresario, a Billy Smart of genetics, a Barnum and Bailey of the genome, an heir to Grandfather Godley and his freak show.

I collect dwarfs.

“What’s all this about, then?” one of them asks loudly to the waiting room of the clinic. The room is decked out with potted plants—aspidistra, ficus—and has bright and hopeful pictures on the walls. The man looks around the place suspiciously. He is there with his family. The wife smiles in a motherly kind of way and clips the ear of the child, a blithe and oblivious three-year-old who is trying to tear a copy of
Cosmopolitan
to pieces. They have come from just down the road, from Olympia, where the
posters are currently showing raging lions and clowns with red noses and crossed eyes and bowler hats with flowers coming out of the top. Chipperfield’s Circus is in town.

“Who is this geezer who wants us?” The father says that.
Geezer
. “Who is this geezer, then?”

A nurse smiles patiently and points out where to fill in the name and date of birth of each member of the family. “Doctor Lambert will then ask you a few questions, if you don’t mind. We do appreciate your offering to help like this.”

“Help? Help who?” He appeals to me as though to an ally. “Who is this geezer Lambert? Any idea?”

“Doctor Lambert will explain everything,” the nurse repeats.

The man looks suspicious. “I don’t want anyone trying to
cure
us. Where’d we be then, eh? Out on the streets without a job.”

“Don’t worry about that,” the nurse replies brightly. “There’s no cure. Now if you just go with the doctor …”

Only then does comprehension dawn. He stares at me. “Oh,
you’re
’im, are you? I fought you was one of us. Blimey, you could knock me down with a feather. In fact that’s exactly what they do, most of the time—knock me down with a feather, I mean.” He roars with laughter, his face knotting up and the sound rattling the windowpanes of the interview room. He is used to laughing to a large audience, making it clear when things are meant to be funny—which is most of the time, presumably. “You from circus folk, too?” he asks.

“No, I’m not.”

The man nods his overlarge head in sympathy. “Just came out of the blue, did you? Luck of the draw, eh? That happens, don’t it? I’m Tom Thumb. Well, obviously. You always end up as Tom Thumb. Typecasting. Pleased to meet you.” He holds out a stubby hand for me to shake with its twin, my own stubby hand. It is like looking in a mirror, that’s the curious thing. Whenever you meet up with another one, it is like looking in a mirror, as though the mutation has overcome all the quirks of inheritable
variation and produced a kind of clone. And yet all we share is a jot, a mere tittle, one trivial spelling mistake in the whole instruction book.

I have often wondered what the real Benedict Lambert would have looked like, the one that is trapped within this absurd, circus body, the one without the macrocephaly, the depressed nasal bridge, the pronounced lumbar lordosis, the short, stubby limbs; the one who is, more or less, the height of my father. What would that crypto-Benedict have looked like? My father was six foot one.

“This is the missus, of course,” Tom Thumb says. “And this ’ere is the son and heir. Little blighter. He’s Joe. Joseph. Not that we’re Jewish; just liked the name, that’s all.” Joe smiles and grabs a fistful of pens from my desk. “There was a sister,” the father adds. “But she died.”

“Died? When was that?”

“Five years ago. She was only eighteen month old, poor little mite. She was badly hit. It does that sometimes, doesn’t it?”

“Yes, it does. Do you have a doctor’s report on her, the postmortem document or anything like that?”

“Don’t know if we do now. You know what it’s like when you’re on the road. You don’t keep much that isn’t vital, and with the poor little mite gone …”

Homozygous. She would have been useful. I have four homozygotes, all referred by hospitals, two from the States, all destined to die in the next months. Stunted, twisted, snared by the malign throw of dice, they are particularly
useful
. Informative.

“Other living relatives?”

“I’ve got a brother.”

“Is he … affected?”

“Normal.”

“And do you think he might help?”

“Dunno. I never see him. To tell the truth, he finds me a bit of an embarrassment.” A shrug. “What do you want from him,
anyway?” Tom Thumb swells with indignant pride and joins me in a brotherhood of the dispossessed. “Isn’t it
us
you’re after?”

“Certainly. But we want to build up as complete a pedigree as possible.”

“Pedigree, is that it? Like dogs.”

I smiled. “A bit like dogs. All we need from each of you is a blood sample. From you, from your brother if he’s willing, from anyone else who is related. Your wife’s relatives as well.”

“Blood samples? She hates the needle, does Deirdre. Don’t you, love?”

Deirdre nodded distractedly, easing pens out of her child’s fist. “Give the doctor his pens back, there’s a good boy.”

“Gives her a right twinge, the needle does. What do you want this blood for anyway? Some kind of Dracula, are you?”

“We grow your cells and extract the DNA from them—”

“Oh, I’ve heard of
that
,” Deirdre says. “It’s on the telly, isn’t it? Fingerprinting. Don’t you remember that Inspector Morse? There was this spot of blood and they found the murderer’s fingerprints from it. Amazing.”

You know pretty soon when you aren’t going to get very far. “Something like that,” I agreed. “We try to find markers on your chromosomes that we can recognize. That enables us to work out which of your chromosomes your son has inherited—”

“Needles in Joe as well? I’m not sure that I can go along with that.”

“It’ll be quite painless, I assure you.”

“And all the other people you get? Aren’t they enough?”

“The more we have, the better. The markers must be informative, you see. We have to find different markers on each of your chromosomes so that we have a way of distinguishing between them.”

“Chromosomes?” Tom Thumb’s face lights up. He is back on familiar ground. “How do you tell the sex of a chromosome?” he asks.

“I don’t know,” I answer dutifully. “How
do
you tell the sex of a chromosome?”

Tom Thumb loves it. “Look up its genes!” he cries. “How about that? Look up its genes!”

“That’s what we’re doing, actually, trying to look up the chromosomes’ genes. And once we find the markers, we follow them from parents to children and attempt to find which markers seem to be inherited with the actual condition. If we can find a marker that goes with the condition, that means that the marker and the gene for achondroplasia are likely to be on the same chromosome. It requires a great deal of patience to do the work, but the idea is fairly straightforward. And you can all help.”

“What good’ll it do us?”

“No good at all, except to know that you will have helped. Maybe in the future there’ll be a therapy. Sometime in the future.”

Once more that suspicious look. “We don’t want any therapy. We’d be out on the streets without a job. What use is a tall dwarf, eh?” He roars with laughter at the idea.