The Descent into the Maelstrom (The Phantom of the Earth Book 4) (8 page)

BOOK: The Descent into the Maelstrom (The Phantom of the Earth Book 4)
11.14Mb size Format: txt, pdf, ePub
ads

Renewed howls shook Oriana’s concentration until she noticed that the ice on the mountain above was melting too. And rolling toward her in an avalanche! She drew two diamond daggers and used them to climb the ice back up to the bridge. She turned. The avalanche crashed into the ravine and the sea. Oriana made her way to the other side of the glacier, where the golden marker hung twisting in the gusts. She activated the message.

IDENTIFY THE UNIQUE SEQUENCE IN THE FOLLOWING GENOME AND INDICATE HOW MANY TIMES IT REPEATS

Oriana grunted. While she devoured novels, Lady Parthenia made her read thousands of pages of random prose, locate the unique phrase that repeated, then count how many times it repeated.

Now she’d moved on to DNA. This particular genome was relatively small at 375,000 base pairs. The letters scrolled through Oriana’s extended consciousness.

CACGTTTCACGTACCGTTACAT

CGTTATCGTTCACGTACTGGTG

AACCCACGTCGTATGTAAGGTT

TCTCGCACGCACGTTTCCTGCG

CACGTATTACGGTATCCGGTTC

ATCTTCTGCACGTTTGTCACAC

CGTCGTCCGTACGGTTCACGTA

Similar to prior exercises with words, phrases, and sentences, Oriana found the unique letters with ease, the repeated sequence being CACGT.

CACGT
TT
CACGT
ACCGTTACAT

CGTTATCGTT
CACGT
ACTGGTG

AACC
CACGT
CGTATGTAAGGTT

TCTCGCACG
CACGT
TTCCTGCG

CACGT
ATTACGGTATCCGGTTC

ATCTTCTG
CACGT
TTGTCACAC

CGTCGTCCGTACGGTT
CACGT
A

Oriana scrolled through the genome and calculated the sequence CACGT appeared 15,547 times. She sent the solution, retrieved the flag, and rushed into the woodlands. She slowed before a mass of thick tree branches wrapped in ice, connected by ice, dead under the ice.

She calculated more than thirty routes in thirty seconds in her extended consciousness. A new riddle. One path would bring her to the next marker. Only one would keep her ahead of Pasha and lead to victory. She determined the direct route based upon a technical readout of the terrain. Neon lines and geometric shapes moved in various directions in her extended consciousness. The smell of singed leaves tickled her nose. The stench from the wolves made her cough. Silver lines crisscrossed and zigzagged as Oriana created the necessary algorithm to determine which way would require passage over the fewest, strongest icy branches.

And she flew.

The spikes on her boots kicked up the ice and left powder in her wake. She weaved through the branches, over the ice, slid to the penultimate marker, and scooped it into her satchel. She sprinted onward until she arrived at an electric-blue fence. A golden marker hung there, but she couldn’t pry it free, and it offered no challenge. She gazed beyond the fence, beyond the platforms. Water flowed over stone, around stone, and beneath stone, defying the law of gravity in this simulated world. Pasha stood beyond another fence, far away on the other side. Between them, Oriana counted sixty-four square platforms, lined up eight-by-eight in a diamond-shaped formation, capped with a mixture of ice and stone.

You two never listen, but here you are,
Lord Thaddeus’s voice boomed.

Oriana swore. Pasha had tricked her, made her think he trailed her when he’d instead discovered an alternate route!

The winds and snowfall quickened. She wiped the melted flakes from her goggles.

A swirl of neon silver dust formed into Janzers, one next to Oriana and one next to Pasha.
The goal of this exercise,
Lord Thaddeus said,
is for each of you to reach the other end without being apprehended by your opponent’s Janzer teammate. Your movement is limited to a neighboring point on the grid, up or down, or left or right. No skipping platforms! No diagonal moves either!

The fences cleared, and Oriana and her Janzer and Pasha and his Janzer stepped cautiously to the corner that led to the first platform. Oriana determined the correct algorithm for her movement. Her calculations showed that if she moved before her Janzer, her capture would be made more difficult, while if her Janzer moved before Pasha, he would be at a disadvantage. She gave orders to her Janzer accordingly.

She moved swiftly to the right, her Janzer to the left, mirroring Pasha’s and his Janzer’s movements, entering the platform grid the way she planned. The Janzer that pursued her took a path she didn’t expect, and as she moved up and left, left and up, she felt a burning, ripping sensation in her calves. Her muscles cramped. She fell and rolled over the side of a platform and hung on long enough to see Pasha storm the other end of the grid, retrieving the final flag. Then she lost her grip and fell so far and fast that she could barely breathe in the thin, freezing air.

A rush of icy water engulfed her. She screamed …

“Oriana,” Lord Thaddeus said, “you’re okay. Do you hear me? Oriana?”

She hung in the Harpoon harness, her bodysuit soaked. She shivered. Her mind adjusted.

Lord Thaddeus lowered her. “You
must
listen! A champion listens. A champion makes wise decisions. A champion stays focused on the goal at hand. You each have the talent to receive the first bid at the Harpoon Auction, but if you don’t start obeying us, you won’t last during the critical-reasoning session.” He peered toward Lady Parthenia. “Hon, have you ever seen candidates behave like this?”

The lady shook her head back and forth and lowered and unlatched Pasha, who wore that smile he always did when he won. He always won!

Oriana sensed his thoughts were focused on the Harpoon leaderboard. She turned. The holographic ticker scrolled along the simulation room’s rim. The Summersets only allowed the twins to see the top one hundred nine-digit ID numbers, forever reminding them that with their genes and development they should be scoring within this elite group of candidates during Harpoon simulations.

Oriana had dreamed of seeing her number on the ticker. Not Pasha’s.

She threw her head back and closed her eyes. When she touched the ground, she fell to her knees and grasped her chest. “That … was … so … real,” she gasped. “More than … any other simulation …” She coughed. “Will the … Harpoons be this … way?”

“The exams will be as real as the walls and furniture in our home,” Lady Parthenia said, “but as we’ve told you many times—”

“Yeah, yeah, yeah, the exams are more about cognitive and learning ability,” Pasha said, “not strength and aggressiveness.” He swiped his long, sweaty hair over his forehead and wiped his nose. “Intelligence, confidence, and moral flexibility are what the Navitan traders want to see, blah, blah, blah—”

Lady Parthenia slapped him. “Don’t catch that tone with me, young man. You’ll do better to keep to our advice next time you’re in the simulator. You weren’t able to calculate the sequencing query. Nor did you properly navigate the woodlands. And who told you taming western wolves was permitted?”

“No one, but—”

“Break the rules on Harpoon day—”

“I used the ZPF! I’m
allowed
to use the ZPF—”

“To solve riddles, yes, that you may do.” Parthenia waved her forefinger. “You may not use it to influence other fauna. I’ve told you that before.” The lady put her hands on her hips. “If you disobey me on the day of the Harpoons, you’ll be disqualified. Is that clear enough for you?”

Pasha frowned, nodded, and rubbed his raw cheek. He stole a sideways glance at his ID number on the leaderboard and bit back a grin as he helped Oriana off the ground. “You all right? I didn’t mean to hurt you.” He didn’t sound sincere.

Oriana didn’t respond. She shivered and limped to the golden bench near the wall.

The Summersets, on their way to the exit, hand-signaled the medical bots, who injected the twins with uficilin.

Oriana sighed at the sweet, instant relief. Newfound energy flowed from her toes to her head. She giggled. Part of it indeed was owed to the medication, while another part was owed to her very first … victory.

For the first time, she solved a riddle during a Harpoon simulation that Pasha could not.

“Forgive me, O.” Pasha bit his lower lip. “You’ll get your number on the leaderboard too. You will.”

“You don’t believe that.” She sensed his consciousness the same way he surely sensed hers. “You think you’ll get the first bid over me.” She pressed her finger to Pasha’s lips before he could speak, smiled, and cleared her mind, the way the lady taught her.

Oriana gave her twin a sisterly kiss, then pressed her lips to his ear. “Ask not for my forgiveness, dear brother, but for my mercy.”

Pasha pulled away from her. His lips looked pouty, his dimples deep. He stood speechless.

Oriana raised her brow. “When I get there, not even you’ll be able to beat me.”

ZPF Impulse Wave: Isabelle Lutetia

Permutation Crypt

2,750 meters deep

“How is it still this disgusting down here?” Lady Isabelle said to Lieutenant Arnao, her voice muffled by a strapless face mask.

She wiped a hand back and forth to clear the soot that permeated the air, then pushed ahead of Arnao through one of the research rooms, shaped like a parallelogram. Janzers roamed everywhere, like platelets, doing what they could to stop the hemorrhaging. They used blowtorches and drills on the plating, pulled singed wires and coils from the floor, and hauled supplies—synism drums, tool chests, water.

“We’re making progress in our repairs, I assure you,” Arnao said. His chameleon military fatigues had turned a mixture of smoky black and gray to match the room. “They used an EMP to disable the coils and disrupt the transformations. Much damage was done, but it can be undone.” He adjusted his face mask. “The survivor awaits you in the infirmary.”

Isabelle nodded and ambled beside her former courier, thinking about the BP. While she
had
anticipated a Polemon strike on the Crypt, she’d not expected it on the evening of the Bicentennial. With so many aristocrats and high-ranking consortium officers gathered in one place and the immediate gratification of ruining the chancellor’s prime event within reach, it seemed a fruit too juicy to ignore. The chatter in Marstone’s Database suggested Hammerton Hall was a top priority. One decoy among several, Isabelle reflected, for the BP attack on the Phanes Beltway had drawn Arnao’s forces to the eastern side of the territory, away from Permutation Crypt, which suggested a diversionary tactic. It had been executed well but was obvious enough in context. The chancellor, who could connect to his Janzer protectors as easily as he could move his own limbs, had been so soused and entranced by the Bicentennial that he didn’t even recall receiving a distress signal.

Isabelle remembered, for while she sought to send reinforcements to the Crypt on the night of the raid, Arnao had sent too many of the capital’s Janzer divisions to the ruckus on the beltway. She should have punished Arnao after he failed to capture the whelp in Mantlestone Village. If he didn’t start performing, she’d be forced to send him to the Lower Level and promote another of her former couriers to take his place. She sighed.

They passed the holding cell where the battle with the BP occurred and a whiff of blood and death made Isabelle shiver. She slowed and turned. Some Janzers wrapped their fallen comrades in body bags, while others scrubbed the ground. Isabelle suspected Jeremiah’s old holding cell may have been revealed to the BP in the information Hans had procured from the DOP prior to his escape and her reacquisition of him on Masimovian Crossing. That he hadn’t had the z-disk on him made her suspect he’d given it to the whelp, Cornelius Selendia. Prior to the Bicentennial, she had left a Granville sphere that projected Jeremiah’s essence in the ZPF. The Janzers who guarded the Crypt knew what to do in the event of an attack. It should’ve been enough. She wanted to know why it wasn’t.

They arrived at the infirmary, where a Janzer survivor lay across a hovering gurney. He grimaced when he sat up. He was a typical Janzer with bronze skin, dark brownish-red eyes, curly hair, and pouty lips—a soldier synthesized, in part, from the supreme chancellor Atticus Masimovian’s DNA, designed for the commonwealth’s, and his, protection. Untypically, he’d lost his limbs, and rather than saluting the supreme director of the Department of Communications and Commonwealth Relations, he nodded to her.

Isabelle stepped to the side of his bed and placed her palm upon his shoulder. They connected, and the scene of the battle in the cell block unfolded before her. She extended her consciousness and searched Marstone’s Database, finding a match: the whelp, Cornelius Selendia, Jeremiah’s youngest son, whom she’d captured in Ypresia Village but lost in Beimeni City after Hans broke them out of the Department of Peace.

She homed in on another BP fighter in a striker synsuit, swinging a diamond sword. She spied the striker’s face beneath his clouded visor. No need to search for Lord Nero Silvana’s likeness, for she knew it well. It came as little surprise that Captain Barão’s striker had turned traitor, though she wouldn’t have anticipated such boldness from him, particularly when his eternal partner lay unconscious in the RDD infirmary. The thought made her smile.

BOOK: The Descent into the Maelstrom (The Phantom of the Earth Book 4)
11.14Mb size Format: txt, pdf, ePub
ads

Other books

Pulpy and Midge by Jessica Westhead
Fateful by Cheri Schmidt
Pregnant In Prosperino by Carla Cassidy
Opposing Forces by Anderson, Juliet
The Power of Three by Kate Pearce
Motor City Witch by Cindy Spencer Pape
Hours of Gladness by Thomas Fleming